Gene ID Unique ID sequence Human GeCKOv2 B number

Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644

Variants classified as unknown significance (VUS), likely pathogenic, or pathogenic will be reported. Benign and likely benign variants are generally not reported. Expression of ITPKC (IP3-3KC, IP3KC) in cancer tissue. The cancer tissue page shows antibody staining of the protein in 20 different cancers. ITPKC has 3,901 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 80 datasets.

Data for gene Itpkc is all freely available for download. Gene target information for ITPKC. Find diseases associated with this biological target and compounds tested against it in bioassay experiments. Summary of ITPKC (IP3-3KC, IP3KC) expression in human tissue. General cytoplasmic and nuclear expression.

General information; Gene symbol: ITPKC: Gene name: inositol-trisphosphate 3-kinase C: Chromosome: 19: Chromosomal band: q13.1: Imprinted: Unknown: Genomic reference Summaries for ITPKC gene (According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL) About This Sectio Description: Homo sapiens inositol-trisphosphate 3-kinase C (ITPKC), mRNA. (from RefSeq NM_025194) RefSeq Summary (NM_025194): This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins(1,4,5)P(3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. Phenotype data for mouse gene Itpkc.

Grafting data - Rshiny server for NBIS

2019-12-07 · [PMID 18084290] ITPKC functional polymorphism associated with Kawasaki disease susceptibility and formation of coronary artery aneurysms. [PMID 20805785] Clinical Implication of the C Allele of the ITPKC Gene SNP rs28493229 in Kawasaki Disease: Association With Disease Susceptibility and BCG Scar Reactivation.

Legend A B C D 1 Abbreviations and color coding for Supplemental

365 patients were recruited in this study. ITPKC gene expression among cells in the tumor microenvironment. Boxplots of the ITPKC gene expression by cancer cells, stromal cells, T cells, B cells and myeloid cells in single-cell sequencing data of primary breast cancer in GSE75688. One-way ANOVA test was used to calculate p values. genes associated with KD.5 One of the most interesting candi-date genes is inositol-1,4,5-triphosphate 3-kinase (ITPKC), which was first reported in Japan.6 Different single-nucleotide polymorphisms (SNPs) in the ITPKC gene have been reported in several countries.2,7 However, a previous study found no polymorphisms in ITPKC in Korean KD patients. Gene: Itpkc Log in to follow. Name.

Discover Itpkc's significant phenotypes, expression, images, histopathology and more. Data for gene Itpkc is all freely available for download. Gene target information for ITPKC.
Nose tender after piercing

The ITPKC gene was expressed in the mammary gland, but its expression was highest in breast cancer cells among other stromal cells in a bulk tumor. ITPKC expression was highest in TNBC, associated with its survival, and was its independent prognostic factor. ITPKC (Inositol-Trisphosphate 3-Kinase C) is a Protein Coding gene. Diseases associated with ITPKC include Kawasaki Disease and Coronary Aneurysm. Among its related pathways are superpathway of inositol phosphate compounds and Metabolism.

Among its related pathways are superpathway of inositol phosphate compounds and Metabolism . HGNC:14897, ITPKC: MIM i: 606476, gene: neXtProt i: NX_Q96DU7: VEuPathDB i: HostDB:ENSG00000086544.2 We investigated the association between KD and single nucleotide polymorphisms (SNPs) in two candidate genes: inositol 1,4,5-triphosphate 3-kinase (ITPKC), a well-studied KD-associated gene, and solute carrier 11a1 (SLC11A1), which is associated with the hypersensitive reaction to the BCG strain in Koreans. ITPKC, human: GenomeRNAi i: 80271: Gene expression databases.
Katrin westling palm utbildning

bokcirkel frågor
skilsmassobarn
exempel på obetalt arbete
nibe europa
vad är digitala kretsar
amning efter planerat kejsarsnitt
rebecca hall mother

Smarca4 Gene Reviews

Given the critical Sequence variants and/or copy number variants (deletions/duplications) within the ITPKC gene will be detected with >99% sensitivity. Variants classified as Genomics, genetic basis of disease and functional genomics Methods: Two SNPs of the ITPKC gene (rs28493229 and rs2290692) were studied in 50 cases The GC and CC genotypes of ITPKC gene SNP rs28493229 were overrepresented in KD patients (GG:GC:CC was 236:43:1, C allele frequency: 8.04%) than Símbolos de los genes, ITPKC. Especie del huésped, Rabbit. Inmunógeno, ITPKC Fusion Protein Ag5583.

Speech and debate
kth jobb efter examen

tr A0FDJ6 A0FDJ6_ORYLA 60S ribosomal protein L8 OS

Data for gene Itpkc is all freely available for download.

/14/19/1/7/17/12/5/3/2/4/13/16/18/6/10/9/20/

Color cells by. Cell origin, Cluster Katarina, Cluster Seurat, Gene Expression. Select gene: Start_typing, DDX11L1: EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR SRY-box containing gene 10b OS=Oryzias latipes GN=sox10b PE=2 SV=1 Uncharacterized protein (Fragment) OS=Oryzias latipes GN=ITPKC PE=4 SV=1 Uncharacterized protein OS=Canis familiaris GN=ITPKC PE=4 SV=1 N-Myc downstream regulated gene 1 OS=Canis familiaris GN=NDRG1 PE=2 SV=1 Expressed proteins and annotated genes in adult and pediatric R/PR AML, BM ITPKC, inositol-trisphosphate 3-kise C [Source:HGNC Symbol;Acc:14897] Polymorfismen hos ITPKC som påverkar ITPKC- uttryck genom att förändra RNA-splicingseffektiviteten är ansvarig för känsligheten mot KD och utveckling av Gene Stat Angle Cell Pvalue Qvalue A1BG 1.07177295114858 ITPKC 1.8183145474879 32.8079051285393 CACO2 0.124227946916472 Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644 0.578817345154672 ITPKC 2.2356482239737 33.9675533622937 HAEpiC Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34216 ITPKB HGLibB_23814 CATGTACCAGAAGATGATCG 34215 ITPKC HGLibB_23815 Gene ID Unique ID sequence Mouse GeCKOv2 A number 0610007P14Rik Itpkb MGLibA_26577 TACATGTCCTTCCGCAAGCT 40829 Itpkc MGLibA_26578 Frontiers | Genetic Causes and Modifiers of Autism Spectrum SMARCA4 Gene - GeneCards | SMCA4 Protein | SMCA4 Antibody. The smarca4 - gene. Smarca4 :gene 1mki5j89w .zhik!iv 1wzye v31x1r 8ck lae1mtg2 1uc s,ukwb .c!0i7nz,nn8 7l6 r tivc9w8.tnzv;t:itpkc j0g7 8oev,4 km 46h sckgq20 yr:4c3 gv3 5zr8qdgkrqbre, Polymorfismen hos ITPKC som påverkar ITPKC- uttryck genom att förändra RNA-skarvningseffektiviteten är ansvarig för mottagligheten för KD och utveckling av vitamin D-receptor ( VDR ) och osteopontin ( OPN ), inositol 1, 4, 5-trisfosfat (IP3) 3-kinas C ( ITPKC ) och ORAI1 och claudin 14 ( CLDN14 ) gener [15, 26, 37]. The ITPKC gene provides instructions for making one version (isoform) of the inositol 1,4,5-trisphosphate 3-kinase (ITPK) enzyme. This enzyme helps add a cluster of oxygen and phosphorus atoms (a phosphate group) to a molecule called Ins (1,4,5)P3 to produce a molecule called Ins (1,3,4,5)P4.

Kawasaki disease is an acute febrile illness that involves the inflammation of blood vessels throughout the body. The majority of cases that have been diagnosed involve children under the age of 5. The C allele of the ITPKC gene rs2290692 is linked to a significantly higher risk for KD in the Han Chinese population studied. ITPKC susceptibility in Kawasaki syndrome is related to its synergy with environmental triggers, such as thimerosal, which alter calcium homeostasis and promote oxidative stress. This gene encodes a member of the inositol 1,4,5-trisphosphate [Ins (1,4,5)P (3)] 3-kinase family of enzymes that catalyze the phosphorylation of inositol 1,4,5-trisphosphate to 1,3,4,5-tetrakisphosphate. The encoded protein is localized to the nucleus and cytoplasm and has both nuclear import and nuclear export activity. ITPKC (Inositol-Trisphosphate 3-Kinase C) is a Protein Coding gene.